Mito-SiPE is a sequence-independent and PCR-free mtDNA enrichment method for accurate ultra-deep mitochondrial sequencing – Communications Biology

culture and tissue sampling

Mice were housed in shoebox cages and fed ProLab RMH 1800 diet (PMI Nutrition International) containing 50 µg vitamin B12/kg diet and 3.3 mg folic acid/kg diet. Breeding mice were fed Picolab Mouse Diet 20 containing 51 μg vitamin B12/kg diet and 2.9 mg folic acid/kg diet. heterozygous polewt/D257A male u polewt/D257A Females were mated. Homozygous mutant and wild-type offspring were 6 months old at which time they were sacrificed. There were 4 polewt/wt Mice (two males and two females) and 4 poleD257A/D257A Mice (two males and two females) used in the pole experiments. Brain, heart, lung, liver, spleen, kidney and muscle tissues were isolated and mitochondrial DNA enrichment was performed on all tissues.

tissue homogenization

The harvested tissue was placed in a homogenization tube with 10 times the volume per gram of fresh homogenization buffer, ie 5 ml of buffer for 500 mg of tissue. Tissues were homogenized until there was no discernible whole tissue. The homogenate was then transferred to 1.5 ml microcentrifuge tubes and centrifuged at 1000X G 1 min at 4°C. The supernatant was transferred to a new microcentrifuge tube and centrifuged at 12,000XG for 10 min at 4°C to pellet mitochondria. The mitochondrial pellet was resuspended with 100 µl resuspension buffer for storage or immediate DNA extraction.

Mitochondrial DNA isolation from fresh mouse tissue

The mitochondrial resuspension was added to 200 µl alkaline lysis buffer, vortexed and placed on ice for 5 min. Potassium acetate buffer (150 µl) was then added and the mixture was slowly vortexed and placed on ice for 5 min. The mixture was centrifuged at 12,000XG for 5 min at 4 °C to pellet proteins and the supernatant was decanted into a new tube. RNase (1 µg) was added to the mixture and left at room temperature for 15 min. Phenol-chloroform (500 µl) was added to each tube, inverted and placed on a shaker/rotator for 20 min. Followed by centrifugation at 12,000 × G carried out for 2 min at room temperature. The aqueous (top) layer was decanted into a new tube (~450 µL was removed from this phase) and 40 µL sodium acetate, 1 µL glycogen (20 mg/mL) and 1200 µL 100% EtOH were admitted. The mixture was inverted and mixed well, then left on dry ice for 60 minutes. The mixture was centrifuged at 12,000X G and the supernatant was removed. The pellet was finally washed twice with 70% ethanol, air dried and resuspended in low TE buffer for sequencing or normal TE buffer for (q)PCR.

Next generation library prep and DNA sequencing

Libraries were generated from approximately 50 ng of genomic DNA using the Accel-NGS 2S Plus DNA Library Kit (Swift Biosciences) using five PCR cycles to minimize PCR bias. DNA samples were sheared to a mean of 300 bp by sonication (Covaris Inc., Woburn, MA). Libraries were tagged with unique dual-index DNA barcodes to allow library pooling and minimize the impact of barcode hopping. Libraries were pooled for sequencing on the NovaSeq 6000 (Illumina) to yield a minimum of 7.6 million 151-base read pairs per single library. The sequencing data were processed using RTA version 3.4.4. DNA sequencing was performed at the NIH Intramural Sequencing Center.

Data Processing and Alignment

Fastq files were aligned to the GRCm38 mouse reference genome with bwa mem using the default parameters47. Picard tools were used to add reading groups and mark and remove duplicates48. Samtools was used to calculate the nuclear and mitochondrial genome coverage for each sample. Finally, R (v3.5.0) and ggplot2 (v3.3.0) were used for statistical analysis and subsequent visualization of charts49.50. Library complexity and fragment sizes were calculated using Picard-Tools v1.4.2 on 15 randomly selected samples (Supplementary Data 2).

Variant calling and mutation analysis

The variant call was implemented with bcftools v1.9 with “bcftools mpileup -f -Q 30 –skip-indels reference_fasta bam_file | bcftools call -mv’ to identify only single nucleotide variants. Filtering was performed by removing all SNVs that had a QUAL score less than 20. The code used for alignment and variant calling is available on github (https://github.com/walshd59/mtDNAhetScripts.git). Of 66,738 variants identified in all samples of our study with an alternative allele frequency of ≥ 0.2%, only 137 of them had an ln (Strand Odds Ratio) value of ≥ 3. Mutation spectrum analysis and further characterization/annotation heteroplasmic variants was performed with SnpEff (v 5.1).51.

mtDNA copy number quantification

Mitochondrial DNA copy number was assessed via qPCR targeting both mitochondrial and nuclear loci as previously described52.53. Briefly, 2.5 µl of LightCycler® 480 SYBR Green I Master (Roche, Molecular Systems, Inc, Germany), 2 µl of DNA (20 ng/µl) and 0.5 µl of primer mix were made in triplicate into a 384-well plate and the reactions given were performed with the QuanStudio 6 Flex (Applied Biosystems, Foster City, CA, USA). The conditions were as follows: 95°C for 5 min, 45 cycles of 95°C for 10 s, 60°C for 10 s and 72°C for 20 s. A melting curve was obtained using 95°C for 5 seconds, 66°C for 1 minute and gradually increasing to 97°C. The copy number of mitochondrial DNA was determined using the following equation:

$$2\times {2}^{\varDelta {{{{{\rm{Ct}}}}}}}({{{{{\rm{where}}}}}}\,\varDelta {{{ {{\rm{Ct}}}}}}={{{{{\rm{Ct}}}}}}({{{{{\rm{mtDNA}}}}}}\,{{{{ {\rm{Gen}}}}}})-{{{{{\rm{Ct}}}}}}({{{{\rm{nDNA}}}}}}\,{{{{ { \rm{Gen}}}}}}))$$

(1)

The following primers were used for human mtDNA copy number: mtDNA tRNA (forward: CACCCAAGAACAGGGTTTGT, reverse: TGGCCATGGGTATGTTGTTA) nuclear DNA β2-microglobulin (forward: TGCTGTCTCCATGTTTGATGTATCT), reverse: TTCTGCTCCCCACCTCTAAGT). Mouse mtDNA copy number was determined using the following primers: mtDNA ND1 (forward: CTAGCAGAAACAAACCGGGC, reverse: CCGGCTGCGTATTCTACGTT) nuclear DNA HK2 (forward: GCCAGCCTCTCCTGATTTTAGTGT, reverse: GGGAACACAAAAGACCTCTTCTGG). These primers are available in the supplemental data file (Supplemental Data 3).

Long-range PCR enrichment of mtDNA

This technique was used to amplify human and mouse mitochondrial DNA in two fragments from a whole DNA extract. DNA was quantifiedabove Nanodrop (Methods 2.2.7) unless otherwise noted. Each PCR reaction consisted of Q5 high-fidelity polymerase (0.02 U/μL), 5X Q5 reaction buffer (1X), 10 mM dNTPs (300 μM), 5 μM forward and reverse primers (0.25 μM ). Template DNA (100 ng) was added to each reaction except for the non-template control (NTC), but an equivalent volume of molecular biology grade water was added instead. The temperature cycles were as follows: 1 × 30 s denaturation 98 °C, 25 × 10 s denaturation 98 °C, 30 s annealing 66 °C, 4 min 30 s elongation 72 °C, 1 × 10 min elongation 72 °C on zum thermal cycling. Both fragments were quantified with Qubit and mixed in equimolar ratios. The following primers were used for each fragment: lrPCR fragment 1 (forward: GGATCCTACTCTCTACAAAC, reverse: TAGTTTGCCGCGTTGGGTGG) and lrPCR fragment 2 (forward: CTACCCCCTCAATCAATCT, reverse: CCGGTTTGTTTCTGCTAGGG). These primers are also available in the Supplementary Data file (Supplementary Data 3).

Mitochondrial isolation via the Qiagen QProteome™ kit

HepG2 cells (2 × 106) were collected, counted and pelleted when 80% confluency was reached. The supernatant was removed and the pellet resuspended in the lysis buffer provided in the kit. Homogenization and mitochondrial isolation were then performed according to the manufacturer’s protocol. Briefly, the cell pellet was resuspended in 1.5 mL of ice-cold disruption buffer by pipetting up and down using a 1 mL pipette tip. Cell disruption was performed using a blunt-ended needle and syringe. The mixture was centrifuged at 1000X G for 10 min at 4°C to pellet proteins and the supernatant was decanted into a new tube. Then centrifugation at 6000 ×G carried out for 2 min at room temperature. This pellet was then resuspended in 200 µl PBS and 20 µl proteinase K. DNA extraction was then performed on the mitochondrial isolate via the Qiagen DNeasy™ Blood and Tissue Kit using the manufacturer’s protocol.

Plasmid-Safe™ digestion for mtDNA enrichment

Whole DNA extractions were treated with Plasmid-Safe ATP-dependent exonuclease (Lucigen) according to the manufacturer’s protocol. Briefly, a plasmid-safe solution was prepared using 42 µl sterile water, 2 µl 25 mM ATP, 5 µl 10X reaction buffer and 1 µl plasmid-safe DNase. This DNase targets linear molecules and as such does not degrade intact mitochondrial DNA as it is circular. The solution was added to the DNA extracted with the QIAprep Miniprep and incubated at 37 °C for 1 h. The DNase was then inactivated with a 30 minute incubation at 70°C.

HepG2 culture conditions

HepG2 cells (Merck; 85011430-1VL) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum in 5% CO2 Incubator. The cells were cultured in 10 ml medium in T75 flasks. Cells were passaged by washing with 5 ml PBS (1X) followed by incubation in 2 ml 0.25% trypsin-EDTA at 37°C for 5 min. Trypsinization was inhibited by addition of 4 ml DMEM. The cells were then collected by centrifugation at 500X G 5 minutes before being counted.

Qiagen QIAprep Miniprep

HepG2 cells (2 × 106) were collected, counted and pelleted when 80% confluency was reached. The supernatant was removed and the pellet was resuspended in the lysis buffer provided in the kit. DNA isolation was performed according to the manufacturer’s protocol, using a silica membrane to capture the mtDNA, which was then collected in 100 µl of the provided elution buffer.

Statistics and Reproducibility

All statistical analyzes included in this work were performed in R (version 4.1.1) and the software package rstatix ​​(version 0.7.0). Sample sizes are described in each experimental figure. Wilcoxon signed rank tests were performed to compare mtDNA copy number of non-enriched and enriched samples from different tissues (Not= 14 for each group). Wilcoxon signed-rank tests were also performed to compare the effect of lrPCR amplification and mito-SiPE on mitochondrial heteroplasmy inpolewt/wt andpoleD257A/D257A (Not= 24 for each genotype). A studentsheassay was used to compare the effect of lrPCR and Mito-SiPE on heteroplasmy in C57BL6 wild-type mice (Not= 6 for the lrPCR group,Not= 12 for the Mito-SiPE group).

solutions

The following solutions were used: homogenization buffer (0.25M sucrose, 10mM EDTA, 30mM Tris-HCl, pH=7.5), resuspension buffer (10mM Tris, 0.15M NaCl, 10mM EDTA, pH=8 ,0), alkaline lysis buffer (0.18 N NaOH, 1% SDS, freshly prepared), potassium acetate buffer (3 M potassium, 5 M acetate), and low-TE buffer (10 mM Tris-HCl, 0.1 mM EDTA , pH = 8.0).

Summary of Reporting

For more information on the research design, see the Nature Portfolio Reporting Summary linked to this article.

#MitoSiPE #sequenceindependent #PCRfree #mtDNA #enrichment #method #accurate #ultradeep #mitochondrial #sequencing #Communications #Biology

Leave a Comment

Your email address will not be published. Required fields are marked *